Stem-loop sequence ath-MIR5026

AccessionMI0017896 (change log)
DescriptionArabidopsis thaliana miR5026 stem-loop
Stem-loop
          -       -aua                             a     a u    g     c c                       cau 
5' auaaaaa gaaaauu    uuuacacgugucaaaaucugagaucgaua auuua c cgug cacga c ugugaguuacuaacuuugaaaac   a
   ||||||| |||||||    ||||||||||||||||||||||||||||| ||||| | |||| ||||| | |||||||||||||||||||||||   g
3' uauuuuu cuuuuaa    aaauguguauaguuuuagauuuuaguuau uaaau g gcac gugcu g auacucaaugauugaaacuuuug   c
          a       aaca                             c     g u    a     a a                       aua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr4: 7844496-7844688 [+]
intergenic
Clustered miRNAs
< 10kb from ath-MIR5026
ath-MIR5026chr4: 7844496-7844688 [+]
ath-MIR850chr4: 7845707-7845927 [+]
ath-MIR863chr4: 7846597-7846899 [+]
Database links

Mature sequence ath-miR5026

Accession MIMAT0020532
Sequence

117 - 

acucauaagaucgugacacgu

 - 137

Get sequence
Evidence experimental; Illumina [1-2]

References

1
PMID:21357774 "MicroRNA activity in the Arabidopsis male germline" Borges F, Pereira PA, Slotkin RK, Martienssen RA, Becker JD J Exp Bot. 62:1611-1620(2011).
2
PMID:21940835 "High-resolution experimental and computational profiling of tissue-specific known and novel miRNAs in Arabidopsis" Breakfield NW, Corcoran DL, Petricka JJ, Shen J, Sae-Seaw J, Rubio-Somoza I, Weigel D, Ohler U, Benfey PN Genome Res. 22:163-176(2012).