Stem-loop sequence gma-MIR1523b

AccessionMI0017902 (change log)
DescriptionGlycine max miR1523b stem-loop
Gene family MIPF0001327; MIR1523
Literature search

1 open access papers mention gma-MIR1523b
(1 sentences)

Stem-loop
   ---------------------------------------------------ua        u  aa                   ua     gaguga g 
5'                                                      gacucauu ug  auaaaugugagcucgggag  augag      u a
                                                        |||||||| ||  |||||||||||||||||||  |||||      |  
3'                                                      cuggguaa ac  uauuuacacucgaguccuc  uacuu      g a
   ugcgaauaaauguacuucgaacagggagaugaccacuuaguuaaucccaguuc        u  cc                   gc     auuuag a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr2: 12591024-12591174 [+]
intergenic
Clustered miRNAs
< 10kb from gma-MIR1523b
gma-MIR1523bchr2: 12591024-12591174 [+]
gma-MIR1523achr2: 12591029-12591123 [-]
Database links

Mature sequence gma-miR1523b

Accession MIMAT0021051
Sequence

61 - 

ucaucgcuccugagcucaca

 - 80

Get sequence
Evidence experimental; SOLiD [1]

References

1