Stem-loop sequence gma-MIR1516b

AccessionMI0017911 (change log)
DescriptionGlycine max miR1516b stem-loop
Gene family MIPF0001353; MIR1516
Literature search

1 open access papers mention gma-MIR1516b
(1 sentences)

Stem-loop
   gauuuguuuugaguauuugggugggguggaauauaacuauauaaguca    u    c g             -      uau 
5'                                                 uaag gcuu u agagcuucucuac agaaaa   a
                                                   |||| |||| | ||||||||||||| ||||||   c
3'                                                 auuc cgaa a uuuugaagagaug uuuuuu   a
   -----------------cgcgacaaaccuauguuuccaucuuacgaaa    u    a g             g      uca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr9: 2548521-2548671 [-]
intergenic
Database links

Mature sequence gma-miR1516b

Accession MIMAT0021061
Sequence

63 - 

agcuucucuacagaaaauaua

 - 83

Get sequence
Evidence experimental; SOLiD [1]

References

1