Stem-loop sequence gma-MIR167h

AccessionMI0017914 (change log)
DescriptionGlycine max miR167h stem-loop
Gene family MIPF0001352; MIR167
Literature search

26 open access papers mention gma-MIR167h
(200 sentences)

Stem-loop 
   -a        g    a      -        gau      a  g 
5'   acuacuag ugaa cugcca caugaucu   cuuucc ca c
     |||||||| |||| |||||| ||||||||   |||||| || a
3'   ugaugguc acuu gacggu guacuaga   gaaggg gu a
   gg        a    c      c        auu      a  g
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr10: 47144854-47144942 [+]
intergenic
Clustered miRNAs
< 10kb from gma-MIR167h
gma-MIR167fchr10: 47144841-47144949 [-]
gma-MIR167hchr10: 47144854-47144942 [+]
Database links

Mature sequence gma-miR167h

Accession MIMAT0021064
Sequence

61 -  

aucaugcuggcagcuucaacuggu

 - 84

Get sequence
Evidence experimental; 454 [1], SOLiD [2]

References

1
PMID:21504877 "MicroRNAs in the shoot apical meristem of soybean" Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL J Exp Bot. 62:2495-2506(2011).
2
PMID:21751852 "Transcriptional analysis of soybean root response to Fusarium virguliforme, the causal agent of sudden death syndrome" Radwan O, Liu Y, Clough SJ Mol Plant Microbe Interact. 24:958-972(2011).