Stem-loop sequence gma-MIR1521b

AccessionMI0017915 (change log)
DescriptionGlycine max miR1521b stem-loop
Literature search

1 open access papers mention gma-MIR1521b
(1 sentences)

Stem-loop
   ----------------------------------------------------------------      g           u         a    uuc    aa 
5'                                                                 ccaaua gauuaugacau uggcaguca cauu   cauu  c
                                                                   |||||| ||||||||||| ||||||||| ||||   ||||  a
3'                                                                 gguuau cuaauacugug acugucagu guaa   guaa  g
   uuuugcaauugucgguacauaguauuagaauaaccuacaauuuuaccacaugcuuuuaauuaca      a           c         a    uga    cu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr11: 12131454-12131604 [+]
intergenic
Clustered miRNAs
< 10kb from gma-MIR1521b
gma-MIR1521achr11: 12131319-12131508 [-]
gma-MIR1521bchr11: 12131454-12131604 [+]
Database links

Mature sequence gma-miR1521b

Accession MIMAT0021065
Sequence

61 - 

gacugucacgugucauaaucaua

 - 83

Get sequence
Evidence experimental; SOLiD [1]

References

1