Stem-loop sequence gma-MIR5039

AccessionMI0017916 (change log)
DescriptionGlycine max miR5039 stem-loop
Literature search

1 open access papers mention gma-MIR5039
(1 sentences)

Stem-loop
   uuacacauucagguacaaaaaugacuauuuauc                a      --      -c                ugcauaacau 
5'                                  caaaauauaauuuaau uucauu  uucucc  uuuuuuaaucguugca          u
                                    |||||||||||||||| ||||||  ||||||  ||||||||||||||||          a
3'                                  guuuuauauuaaauua aaguag  aagagg  aaaaaauuagcaaugu          c
   ---------------------------------                g      aa      aa                ucacuaauaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr12: 32675496-32675646 [+]
intergenic
Database links

Mature sequence gma-miR5039

Accession MIMAT0021066
Sequence

61 - 

cccuuuuuuaaucguugcaug

 - 81

Get sequence
Evidence experimental; SOLiD [1]

References

1