![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence gma-MIR396f |
|||||
Accession | MI0017919 (change log) | ||||
Description | Glycine max miR396f stem-loop | ||||
Gene family | MIPF0000047; MIR396 | ||||
Literature search |
![]()
25 open access papers mention gma-MIR396f | ||||
Stem-loop |
uagcuucuucagcauuucaacuuccaugcuugcuugaaca ------u c gc uu uaau gcu 5' aguccug uaug uuuuccaca uuucuugaacuuc augcc gca a ||||||| |||| ||||||||| ||||||||||||| ||||| ||| 3' ucaggau guac aaaaggugu aaagaauuugaag uacgg ugu u ---------------------------------------- cuaaacu a aa -u ---- agu |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence gma-miR396f |
|
Accession | MIMAT0021069 |
Sequence |
62 - agcuuucuugaacuucuuaugccua - 86 |
Evidence | experimental; SOLiD [1], Illumina [2] |
References |
|
1 |
PMID:21751852
"Transcriptional analysis of soybean root response to Fusarium virguliforme, the causal agent of sudden death syndrome"
Mol Plant Microbe Interact. 24:958-972(2011).
|
2 |
PMID:21663675
"Identification of novel soybean microRNAs involved in abiotic and biotic stresses"
BMC Genomics. 12:307(2011).
|