Stem-loop sequence tre-mir-5045

AccessionMI0017930 (change log)
DescriptionTerebratulina retusa miR-5045 stem-loop
Gene family MIPF0001341; mir-5045
Stem-loop
   ggu                   cuaa 
5'    cuaaaggauugucucuaga    a
      |||||||||||||||||||     
3'    gauuuucugauagagaucu    g
   -cu                   cucu 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence tre-miR-5045

Accession MIMAT0021078
Sequence

1 - 

ggucuaaaggauugucucuag

 - 21

Get sequence
Evidence experimental; 454 [1], Northern [1]

References

1
PMID:21535467 "Molecular paleobiological insights into the origin of the Brachiopoda" Sperling EA, Pisani D, Peterson KJ Evol Dev. 13:290-303(2011).