Stem-loop sequence bdi-MIR408

AccessionMI0017941 (change log)
DescriptionBrachypodium distachyon miR408 stem-loop
Gene family MIPF0000102; MIR408
Stem-loop
   ---      gaga      u ga    a   u    u     u       aaauuacguucguuauuacuuccac 
5'    ggggag    caggga g  gcag gca ggga ggggc aacagca                         u
      ||||||    |||||| |  |||| ||| |||| ||||| |||||||                          
3'    ccccuc    gucccu c  cguc cgu cccu ccucg uuguugu                         a
   cgu      ---g      u uc    a   c    c     -       gucgucgucgucgagagugucguau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence bdi-miR408-5p

Accession MIMAT0020550
Sequence

11 - 

cagggauggagcagagcaugg

 - 31

Get sequence
Evidence experimental; Illumina [3]

Mature sequence bdi-miR408-3p

Accession MIMAT0027039
Sequence

117 - 

cugcacugccucuucccuggc

 - 137

Get sequence
Evidence experimental; Illumina [3]

References

1
PMID:21352554 "Discovery of barley miRNAs through deep sequencing of short reads" Schreiber AW, Shi BJ, Huang CY, Langridge P, Baumann U BMC Genomics. 12:129(2011).
2
PMID:21371551 "Implementation of a de novo genome-wide computational approach for updating Brachypodium miRNAs" Baev V, Milev I, Naydenov M, Apostolova E, Minkov G, Minkov I, Yahubyan G Genomics. 97:282-293(2011).
3
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).