![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence osa-MIR5074 |
|||||
Accession | MI0017950 (change log) | ||||
Description | Oryza sativa miR5074 stem-loop | ||||
Literature search |
4 open access papers mention osa-MIR5074 | ||||
Stem-loop |
cgucauu - -- cac u - ccaa u c uccc uc cc c - gc 5' cg ggaag gc cg cgg gaucg gucg cg cg cg cg gcuucg cg uc c || ||||| || || ||| ||||| |||| || || || || |||||| || || 3' gc ccuuc cg gc gcc cuagc cagc gc gc gc gc cgaggc gc ag g -gccgcu u uu -cc c u ---c u c ---c -u ca c u aa |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Comments |
This is a predicted homolog of a miRNA identified by Illumina deep sequencing in barley (Hordeum vulgare) [1]. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence osa-miR5074 |
|
Accession | MIMAT0020559 |
Sequence |
11 - gaaggccaccgucgggaucgc - 31 |
Deep sequencing | 1 reads, 1 experiments |
Evidence | not experimental |
Database links |
|
References |
|
1 |
PMID:21352554
"Discovery of barley miRNAs through deep sequencing of short reads"
BMC Genomics. 12:129(2011).
|