Stem-loop sequence bdi-MIR1878

AccessionMI0017956 (change log)
DescriptionBrachypodium distachyon miR1878 stem-loop
Gene family MIPF0001218; MIR1878
Stem-loop
   uc       c                       ----aa    u     a 
5'   acuauug aaacuuagucugaacacuauaaa      augc caugu a
     ||||||| |||||||||||||||||||||||      |||| |||||  
3'   ugaugac uuugaguuagacuugugauguuu      uacg guaua a
   gu       a                       agauac    c     a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
4: 37301958-37302055 [+]
intergenic
Database links

Mature sequence bdi-miR1878-5p

Accession MIMAT0027040
Sequence

13 - 

acuuagucugaacacuauaaaaaa

 - 36

Get sequence
Evidence experimental; Illumina [3]

Mature sequence bdi-miR1878-3p

Accession MIMAT0020565
Sequence

65 - 

auuuguaguguucagauugaguuu

 - 88

Get sequence
Evidence experimental; Illumina [3]

References

1
PMID:21352554 "Discovery of barley miRNAs through deep sequencing of short reads" Schreiber AW, Shi BJ, Huang CY, Langridge P, Baumann U BMC Genomics. 12:129(2011).
2
PMID:21371551 "Implementation of a de novo genome-wide computational approach for updating Brachypodium miRNAs" Baev V, Milev I, Naydenov M, Apostolova E, Minkov G, Minkov I, Yahubyan G Genomics. 97:282-293(2011).
3
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).