Stem-loop sequence osa-MIR5078

AccessionMI0017966 (change log)
DescriptionOryza sativa miR5078 stem-loop
Literature search

2 open access papers mention osa-MIR5078
(2 sentences)

Stem-loop
       a a              cua  ua                                    u              u        aacaccugccaauucccuccaugucaugucgucgucccauggcagagcgcuccaaccuggcgcauccgaugaaguagccgucgcugcauaugcauugguuacagcagcaccagcacuacaggaugccau 
5' ggcu c auaaaaugccacgg   aa  ggggguguucgcuagaaugucaucguggacgguauu cccuuggaucuucu cuuccucc                                                                                                                                 c
   |||| | ||||||||||||||   ||  |||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||                                                                                                                                  
3' ccga g uauuuuacggugcc   uu  uccccacaagcgaucuuacgguaguaccuguuauaa gggaaccuagaaga gaaggagg                                                                                                                                 g
       a a              agc  gc                                    c              -        gagcugcaacccacgaccaguaaggggagguacaguacgguagcaaccgaggucgucgucgaguacuacgggugguggucacggacugacgguucuguuccucgagacgaaguguaagcacgagccgcc 
Get sequence
Deep sequencing
130 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This is a predicted homolog of a miRNA identified by Illumina deep sequencing in barley (Hordeum vulgare) [1].

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr5: 21907862-21908296 [-]
intergenic
Database links

Mature sequence osa-miR5078

Accession MIMAT0020575
Sequence

405 - 

ccucguucgaccguggcauuu

 - 425

Get sequence
Deep sequencing3 reads, 2 experiments
Evidence not experimental
Database links

References

1
PMID:21352554 "Discovery of barley miRNAs through deep sequencing of short reads" Schreiber AW, Shi BJ, Huang CY, Langridge P, Baumann U BMC Genomics. 12:129(2011).