Stem-loop sequence ssc-let-7a-2

AccessionMI0017984 (change log)
DescriptionSus scrofa let-7a-2 stem-loop
Gene family MIPF0000002; let-7
Literature search

49 open access papers mention ssc-let-7a-2
(147 sentences)

Stem-loop
   --   ug     u   gu                uuagggucacac 
5'   cac  uggga gag  aguagguuguauaguu            c
     |||  ||||| |||  ||||||||||||||||            c
3'   gug  auccu uuc  ucaucuaacauaucaa            a
   ua   ca     -   ug                uagagggucacc 
Get sequence
Deep sequencing
64842 reads, 2.01e+04 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr3: 44864433-44864524 [+]
intergenic
Clustered miRNAs
< 10kb from ssc-let-7a-2
ssc-let-7a-2chr3: 44864433-44864524 [+]
ssc-let-7f-2chr3: 44864800-44864896 [+]
ssc-let-7dchr3: 44867267-44867362 [+]
Database links

Mature sequence ssc-let-7a

Accession MIMAT0013865
Sequence

11 - 

ugagguaguagguuguauaguu

 - 32

Get sequence
Deep sequencing151662 reads, 15 experiments
Evidence experimental; Illumina [1-2]

References

1
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
2
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).