Stem-loop sequence ssc-mir-545

AccessionMI0017994 (change log)
DescriptionSus scrofa miR-545 stem-loop
Gene family MIPF0000098; mir-95
Stem-loop
   --         - u            auug     auaaa 
5'   uuaguaggc c caguaaauguuu    gauga     u
     ||||||||| | ||||||||||||    |||||     g
3'   aaucguccg g guuauuuacaaa    cuacu     a
   gc         u u            -caa     cagua 
Get sequence
Deep sequencing
98 reads, 0 reads per million, 11 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chrX: 67530196-67530274 [-]
sense
ENSSSCT00000021268 ; ssc-mir-545.1-201; exon 1
Clustered miRNAs
< 10kb from ssc-mir-545
ssc-mir-374achrX: 67530361-67530440 [-]
ssc-mir-545chrX: 67530196-67530274 [-]
Database links

Mature sequence ssc-miR-545-5p

Accession MIMAT0020593
Previous IDsssc-miR-545*
Sequence

11 - 

ucaguaaauguuuauuggaug

 - 31

Get sequence
Deep sequencing16 reads, 8 experiments
Evidence experimental; Illumina [1]

Mature sequence ssc-miR-545-3p

Accession MIMAT0020594
Previous IDsssc-miR-545
Sequence

48 - 

aucaacaaacauuuauugugug

 - 69

Get sequence
Deep sequencing78 reads, 9 experiments
Evidence experimental; Illumina [1]

References

1
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).