Stem-loop sequence osa-MIR5143a

Accession MI0018055
Previous IDs osa-MIR5143
Description Oryza sativa miR5143a stem-loop
Gene family MIPF0001617; MIR5143
Stem-loop 
----cc   u       -     a             a  c   a    g ug c  c     cacuaucaagacacuucucccaguccauuuugucuguugagca 
      uca acuuccu cauug ccaauauaccaca aa acu caau u  g cu uuuac                                           u
      ||| ||||||| ||||| ||||||||||||| || ||| |||| |  | || |||||                                           c
      agu ugaagga guaac gguuguauggugu uu uga guug g  c ga aaaug                                           a
augcua   c       u     -             a  u   c    g gu u  c     ucuccuacuacaucucguuccgugaggugugaauaauuacagg
Get sequence
Deep sequencing
141 reads, 2 experiments
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr1: 8417107-8417315 [-]
intergenic
Clustered miRNAs
< 10kb from osa-MIR5143a
osa-MIR5143a Chr1: 8417107-8417315 [-]
osa-MIR5143b Chr1: 8415808-8415998 [-]

Mature sequence osa-miR5143a

Accession MIMAT0021087
Previous IDs osa-miR5143
Sequence

174 -  

ugugguauguuggcaauguaggaa

 - 197

Get sequence
Deep sequencing 117 reads, 2 experiments
Evidence experimental; Solexa [1-2]

References

1
PMID:21525786 "Genome-wide discovery and analysis of microRNAs and other small RNAs from rice embryogenic callus" Chen CJ, liu Q, Zhang YC, Qu LH, Chen YQ, Gautheret D RNA Biol. 8:538-547(2011).
2
PMID:22158467 "Massive analysis of rice small RNAs: mechanistic implications of regulated microRNAs and variants for differential target RNA cleavage" Jeong DH, Park S, Zhai J, Gurazada SG, De Paoli E, Meyers BC, Green PJ Plant Cell. 23:4185-4207(2011).