Stem-loop sequence bdi-MIR169j

AccessionMI0018082 (change log)
DescriptionBrachypodium distachyon miR169j stem-loop
Gene family MIPF0000832; MIR169_5
Literature search

3 open access papers mention bdi-MIR169j
(27 sentences)

Stem-loop
   ---    -     -a   a      cuac    g    c      u      c   c   ca   uu   g        ---c      aaaacuaa 
5'    cuua caugg  gau aggagc    cucu uuag caggaa ggcuug cua gca  cau  uuc guucauca    aggggc        c
      |||| |||||  ||| ||||||    |||| |||| |||||| |||||| ||| |||  |||  ||| ||||||||    ||||||         
3'    ggau guacc  cua uccucg    gaga gauc guccuu ccgaac ggu cgu  gug  gag cagguagu    uccccg        u
   guc    c     cc   c      ---u    g    a      -      u   a   cg   -u   g        auga      auagaggu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
4: 44513754-44513936 [+]
intergenic
Clustered miRNAs
< 10kb from bdi-MIR169j
bdi-MIR169i4: 44509037-44509211 [+]
bdi-MIR169j4: 44513754-44513936 [+]
Database links

Mature sequence bdi-miR169j-5p

Accession MIMAT0020657
Sequence

31 - 

uagccaggaauggcuugccua

 - 51

Get sequence
Evidence experimental; Illumina [2]

Mature sequence bdi-miR169j-3p

Accession MIMAT0027042
Sequence

132 - 

uggucaagccuuccugacuagg

 - 153

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:21371551 "Implementation of a de novo genome-wide computational approach for updating Brachypodium miRNAs" Baev V, Milev I, Naydenov M, Apostolova E, Minkov G, Minkov I, Yahubyan G Genomics. 97:282-293(2011).
2
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).