Stem-loop sequence bdi-MIR390a

AccessionMI0018085 (change log)
Previous IDsbdi-MIR390
DescriptionBrachypodium distachyon miR390 stem-loop
Gene family MIPF0000101; MIR390
Literature search

3 open access papers mention bdi-MIR390a
(37 sentences)

Stem-loop
   ccaaucgagauc      ---    aau  u  a         g         cuagguucacugcaaccaacaagagaaccggccaucgauauauacauauaua 
5'             gguaag   gaac   cc ug agcucagga ggauagcgc                                                    u
               ||||||   ||||   || || ||||||||| |||||||||                                                    g
3'             ccauuc   cuug   gg ac ucgaguccu ucuaucgcg                                                    u
   -acacacccgua      uug    cuu  c  c         a         aagccugcuugucuagcugccuuggucguucucuagcuagccagcuagcucc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
1: 2722067-2722275 [+]
intergenic
Database links

Mature sequence bdi-miR390a-5p

Accession MIMAT0020660
Previous IDsbdi-miR390
Sequence

31 - 

aagcucaggagggauagcgcc

 - 51

Get sequence
Evidence experimental; Illumina [2]

Mature sequence bdi-miR390a-3p

Accession MIMAT0027043
Sequence

159 - 

cgcuaucuauccugagcucca

 - 179

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:21371551 "Implementation of a de novo genome-wide computational approach for updating Brachypodium miRNAs" Baev V, Milev I, Naydenov M, Apostolova E, Minkov G, Minkov I, Yahubyan G Genomics. 97:282-293(2011).
2
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).