Stem-loop sequence bdi-MIR166d

AccessionMI0018089 (change log)
DescriptionBrachypodium distachyon miR166d stem-loop
Gene family MIPF0000004; MIR166
Literature search

2 open access papers mention bdi-MIR166d
(16 sentences)

Stem-loop
   -----ucgcuggugcauguauggcgca    a        uu        g      uagcuagcagcuagcacggaucaucca 
5'                            guug ggggaaug  gucugguu gagacc                           u
                              |||| ||||||||  |||||||| ||||||                            
3'                            caac ccccuuac  cggaccag cuuugg                           a
   cucgcuucuucuagcuagcucaacucu    c        uu        g      cgcgcguauacgucgcagcuuagcuag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
1: 71419377-71419541 [-]
intergenic
Database links

Mature sequence bdi-miR166d-5p

Accession MIMAT0027046
Sequence

30 - 

ggaauguugucugguuggaga

 - 50

Get sequence
Evidence experimental; Illumina [2]

Mature sequence bdi-miR166d-3p

Accession MIMAT0020664
Sequence

113 - 

ucggaccaggcuucauucccc

 - 133

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:21371551 "Implementation of a de novo genome-wide computational approach for updating Brachypodium miRNAs" Baev V, Milev I, Naydenov M, Apostolova E, Minkov G, Minkov I, Yahubyan G Genomics. 97:282-293(2011).
2
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).