Stem-loop sequence bdi-MIR166b

AccessionMI0018092 (change log)
DescriptionBrachypodium distachyon miR166b stem-loop
Gene family MIPF0000004; MIR166
Literature search

2 open access papers mention bdi-MIR166b
(16 sentences)

Stem-loop
   ---  u     ----          uucgu    a        uu      cu       cu ---uu   u    ugc      c        ccuccucaa    ucu      ga         ga  ag 
5'    gc agaga    gggagccuuu     uuug ggggaaug  gucugg  cgggguu  c     uau ucua   cucucu uauccccc         ucuc   agcuuu  uuggaucga  ga  a
      || |||||    ||||||||||     |||| ||||||||  ||||||  |||||||  |     ||| ||||   |||||| ||||||||         ||||   ||||||  |||||||||  ||  u
3'    cg ucucu    cccucgggaa     aaac ccccuuac  cggacc  gcucuag  g     aug agau   gagaga guaggggg         agag   uugaga  aaccuagcu  cu  c
   cuc  -     agua          --cau    c        uu      ag       au ugugu   c    ---      a        --------a    -uc      ag         ag  ag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
1: 30655617-30655860 [-]
intergenic
Database links

Mature sequence bdi-miR166b-5p

Accession MIMAT0027048
Sequence

31 - 

ggaauguugucuggcucgggg

 - 51

Get sequence
Evidence experimental; Illumina [2]

Mature sequence bdi-miR166b-3p

Accession MIMAT0020667
Sequence

192 - 

ucggaccaggcuucauucccc

 - 212

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:21371551 "Implementation of a de novo genome-wide computational approach for updating Brachypodium miRNAs" Baev V, Milev I, Naydenov M, Apostolova E, Minkov G, Minkov I, Yahubyan G Genomics. 97:282-293(2011).
2
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).