Stem-loop sequence bdi-MIR160b

AccessionMI0018093 (change log)
DescriptionBrachypodium distachyon miR160b stem-loop
Gene family MIPF0000032; MIR160
Literature search

2 open access papers mention bdi-MIR160b
(5 sentences)

Stem-loop
   ucgauccgaauua         c -   ---------      c       c          a   -   gc      -    
5'              aucgaucau g gcu         gcgugc uggcucc uguaugccac cau gua  ccgauc cgu 
                ||||||||| | |||         |||||| ||||||| |||||||||| ||| |||  |||||| || g
3'              uagcuagua c cga         cguacg accgagg acgugcggug gug cgu  gguugg gcc 
   ------accuacc         c u   acauacaua      a       a          g   u   -a      a    
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
1: 28020411-28020556 [-]
intergenic
Database links

Mature sequence bdi-miR160b-5p

Accession MIMAT0020668
Sequence

31 - 

ugccuggcucccuguaugcca

 - 51

Get sequence
Evidence experimental; Illumina [2]

Mature sequence bdi-miR160b-3p

Accession MIMAT0027049
Sequence

94 - 

gcgugcaaggagccaagcaug

 - 114

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:21371551 "Implementation of a de novo genome-wide computational approach for updating Brachypodium miRNAs" Baev V, Milev I, Naydenov M, Apostolova E, Minkov G, Minkov I, Yahubyan G Genomics. 97:282-293(2011).
2
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).