Stem-loop sequence bdi-MIR167c

AccessionMI0018095 (change log)
DescriptionBrachypodium distachyon miR167c stem-loop
Gene family MIPF0000023; MIR167_1
Literature search

2 open access papers mention bdi-MIR167c
(7 sentences)

Stem-loop
   --uucacuugcugug        ucu  g  c         -            acgagaguuccucgucugauagcaau 
5'                gugcaucu   ag ag ugaagcugc cagcaugaucug                          g
                  ||||||||   || || ||||||||| ||||||||||||                           
3'                cacguagg   uc uc acuuugacg gucguacuagac                          u
   auacuugucauagaa        ugu  g  u         u            uaguaaucaguacuguucucuuaauu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
1: 54067075-54067233 [+]
intergenic
Database links

Mature sequence bdi-miR167c-5p

Accession MIMAT0020670
Sequence

31 - 

ugaagcugccagcaugaucuga

 - 52

Get sequence
Evidence experimental; Illumina [2]

Mature sequence bdi-miR167c-3p

Accession MIMAT0027050
Sequence

108 - 

gaucaugcugugcaguuucauc

 - 129

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:21371551 "Implementation of a de novo genome-wide computational approach for updating Brachypodium miRNAs" Baev V, Milev I, Naydenov M, Apostolova E, Minkov G, Minkov I, Yahubyan G Genomics. 97:282-293(2011).
2
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).