Stem-loop sequence bdi-MIR396d

AccessionMI0018096 (change log)
DescriptionBrachypodium distachyon miR396d stem-loop
Gene family MIPF0000047; MIR396
Literature search

2 open access papers mention bdi-MIR396d
(4 sentences)

Stem-loop
   uauuggau  a   ----a   - c        u  c            c      ugcaucugcaauggaugcuacuu 
5'         gc ugc     ugg c cucuuugc au uuccacagcuuu uugaac                       a
           || |||     ||| | |||||||| || |||||||||||| ||||||                       g
3'         cg acg     acc g gagagacg ua agggugucgaaa aacuug                       c
   ---uaauu  -   gguua   a a        u  a            u      ucgugagaacgucaauucguauu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
1: 46677004-46677155 [-]
intergenic
Database links

Mature sequence bdi-miR396d-5p

Accession MIMAT0020671
Sequence

33 - 

uuccacagcuuucuugaacug

 - 53

Get sequence
Evidence experimental; Illumina [2]

Mature sequence bdi-miR396d-3p

Accession MIMAT0027051
Sequence

101 - 

guucaauaaagcugugggaaa

 - 121

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:21371551 "Implementation of a de novo genome-wide computational approach for updating Brachypodium miRNAs" Baev V, Milev I, Naydenov M, Apostolova E, Minkov G, Minkov I, Yahubyan G Genomics. 97:282-293(2011).
2
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).