Stem-loop sequence bdi-MIR160c

AccessionMI0018100 (change log)
DescriptionBrachypodium distachyon miR160c stem-loop
Gene family MIPF0000032; MIR160
Literature search

2 open access papers mention bdi-MIR160c
(5 sentences)

Stem-loop
   -----uaa      -    -    caa acu    u    c       c          a   -    c c    -  u 
5'         auugau gauc ugau   g   gugc gugc uggcucc uguaugccac cau guag c agcc ca g
           |||||| |||| ||||   |   |||| |||| ||||||| |||||||||| ||| |||| | |||| ||  
3'         uaauua cuag auua   c   uacg uacg accgagg acgugcggug gug cguc g uugg gu a
   uuggucuc      a    u    -cg -au    -    a       a          g   u    c u    u  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
3: 3414575-3414722 [-]
intergenic
Database links

Mature sequence bdi-miR160c-5p

Accession MIMAT0020675
Sequence

31 - 

ugccuggcucccuguaugcca

 - 51

Get sequence
Evidence experimental; Illumina [2]

Mature sequence bdi-miR160c-3p

Accession MIMAT0027054
Sequence

96 - 

gcgugcaaggagccaagcaug

 - 116

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:21371551 "Implementation of a de novo genome-wide computational approach for updating Brachypodium miRNAs" Baev V, Milev I, Naydenov M, Apostolova E, Minkov G, Minkov I, Yahubyan G Genomics. 97:282-293(2011).
2
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).