Stem-loop sequence bdi-MIR167d

AccessionMI0018102 (change log)
DescriptionBrachypodium distachyon miR167d stem-loop
Gene family MIPF0000023; MIR167_1
Literature search

3 open access papers mention bdi-MIR167d
(8 sentences)

Stem-loop
   ------    cgg  caa    a     -      gu         c            -uc   guccaacguaaccgaacacaugucgaucgacuuccgauugcgc 
5'       ugga   cu   uuug uggug ugagag  ugaagcugc agcaugaucuga   acc                                           c
         ||||   ||   |||| ||||| ||||||  ||||||||| ||||||||||||   |||                                            
3'       accu   ga   aagc accac acucuc  acuucgacg uuguacuagacu   ugg                                           g
   aauuaa    --a  ---    c     u      uc         -            ucu   gaacguuaccuucgaguauauauauauaaggaugguucuauug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
3: 3632405-3632608 [-]
intergenic
Database links

Mature sequence bdi-miR167d-5p

Accession MIMAT0020677
Sequence

31 - 

ugaagcugccagcaugaucuga

 - 52

Get sequence
Evidence experimental; Illumina [2]

Mature sequence bdi-miR167d-3p

Accession MIMAT0027056
Sequence

154 - 

agaucauguugcagcuucac

 - 173

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:21371551 "Implementation of a de novo genome-wide computational approach for updating Brachypodium miRNAs" Baev V, Milev I, Naydenov M, Apostolova E, Minkov G, Minkov I, Yahubyan G Genomics. 97:282-293(2011).
2
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).