Stem-loop sequence bdi-MIR160d

AccessionMI0018106 (change log)
DescriptionBrachypodium distachyon miR160d stem-loop
Gene family MIPF0000032; MIR160
Literature search

2 open access papers mention bdi-MIR160d
(5 sentences)

Stem-loop
   ------       -aa  u  agc   uguu         c       c         cu     aua     --au  cu 
5'       agagacg   gg ga   uua    gggaugugc uggcucc uguaugcca  caucu   gcaac    uc  u
         |||||||   || ||   |||    ||||||||| ||||||| |||||||||  |||||   |||||    ||   
3'       ucucugc   cc cu   agu    cccuauacg accgagg acgugcggu  guagg   cguug    ag  c
   uacucu       caa  -  ---   -ucc         a       c         ag     auc     gagu  uc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
3: 12734293-12734442 [+]
intergenic
Database links

Mature sequence bdi-miR160d-5p

Accession MIMAT0020681
Sequence

31 - 

ugccuggcucccuguaugcca

 - 51

Get sequence
Evidence experimental; Illumina [2]

Mature sequence bdi-miR160d-3p

Accession MIMAT0027058
Sequence

100 - 

gcgugcacggagccaagcaua

 - 120

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:21371551 "Implementation of a de novo genome-wide computational approach for updating Brachypodium miRNAs" Baev V, Milev I, Naydenov M, Apostolova E, Minkov G, Minkov I, Yahubyan G Genomics. 97:282-293(2011).
2
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).