Stem-loop sequence bdi-MIR160e

AccessionMI0018107 (change log)
DescriptionBrachypodium distachyon miR160e stem-loop
Gene family MIPF0000032; MIR160
Literature search

2 open access papers mention bdi-MIR160e
(5 sentences)

Stem-loop
   -u    uaauuaa    u     u    ----      c         g       u  ga  ag   a   cc 
5'   aagg       uggg gaugu gccu    uccugc uggcucccu aaugcca cu  ga  cac cca  g
     ||||       |||| ||||| ||||    |||||| ||||||||| ||||||| ||  ||  ||| |||  u
3'   uucc       gcuc cugca ugga    gggacg acugaggga uuacggu gg  cu  gug ggu  g
   ac    cucauuc    -     -    cguu      u         g       u  uc  cg   c   cc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
3: 41554285-41554428 [+]
intergenic
Database links

Mature sequence bdi-miR160e-5p

Accession MIMAT0020682
Sequence

31 - 

ugccuggcucccugaaugcca

 - 51

Get sequence
Evidence experimental; Illumina [2]

Mature sequence bdi-miR160e-3p

Accession MIMAT0027059
Sequence

93 - 

gcauugagggagucaugcagg

 - 113

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:21371551 "Implementation of a de novo genome-wide computational approach for updating Brachypodium miRNAs" Baev V, Milev I, Naydenov M, Apostolova E, Minkov G, Minkov I, Yahubyan G Genomics. 97:282-293(2011).
2
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).