Stem-loop sequence bdi-MIR172a

AccessionMI0018110 (change log)
DescriptionBrachypodium distachyon miR172a stem-loop
Gene family MIPF0000035; MIR172
Literature search

6 open access papers mention bdi-MIR172a
(17 sentences)

Stem-loop
   --a     ---cacgcac     -   c    a         c  c        a     -    ---    ag    aau 
5'    ggcgg          agucg gcg uugc ggugcagca ca caagauuc caucg gguu   cucc  ucgu   u
      |||||          ||||| ||| |||| ||||||||| || |||||||| ||||| ||||   ||||  ||||   a
3'    cugcu          ucagc cgc aacg cuacgucgu gu guucuaag guagu ccaa   gagg  agca   a
   uaa     auacuacuca     u   c    g         a  a        a     a    cau    --    auu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
3: 55737301-55737453 [-]
intergenic
Database links

Mature sequence bdi-miR172a-5p

Accession MIMAT0027061
Sequence

31 - 

gcagcaccaccaagauucaca

 - 51

Get sequence
Evidence experimental; Illumina [2]

Mature sequence bdi-miR172a-3p

Accession MIMAT0020685
Sequence

99 - 

agaaucuugaugaugcugcau

 - 119

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:21371551 "Implementation of a de novo genome-wide computational approach for updating Brachypodium miRNAs" Baev V, Milev I, Naydenov M, Apostolova E, Minkov G, Minkov I, Yahubyan G Genomics. 97:282-293(2011).
2
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).