![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence bdi-MIR166e |
|||||
Accession | MI0018112 (change log) | ||||
Description | Brachypodium distachyon miR166e stem-loop | ||||
Gene family | MIPF0000004; MIR166 | ||||
Literature search |
![]()
2 open access papers mention bdi-MIR166e | ||||
Stem-loop |
-------- aua aagg uuu u uu cu ---g - agaa 5' ggg gca gggagcuu uacuu gaggggaaug gucugg cgaggu cu gagaucgag c ||| ||| |||||||| ||||| |||||||||| |||||| |||||| || ||||||||| u 3' ucc ugu cccucgaa augaa cuccccuuac cggacc gcucua ga cucuagcuu u ucuuagcg -gg ---g --- - uu ag guua u aaag |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence bdi-miR166e-5p |
|
Accession | MIMAT0027063 |
Sequence |
35 - ggaauguugucuggcucgagg - 55 |
Evidence | experimental; Illumina [2] |
Mature sequence bdi-miR166e-3p |
|
Accession | MIMAT0020687 |
Sequence |
98 - cucggaccaggcuucauuccc - 118 |
Evidence | experimental; Illumina [2] |
References |
|
1 |
PMID:21371551
"Implementation of a de novo genome-wide computational approach for updating Brachypodium miRNAs"
Genomics. 97:282-293(2011).
|
2 |
PMID:23264558
"Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon"
Mol Plant. 6:423-443(2013).
|