Stem-loop sequence bdi-MIR166c

AccessionMI0018113 (change log)
DescriptionBrachypodium distachyon miR166c stem-loop
Gene family MIPF0000004; MIR166
Literature search

2 open access papers mention bdi-MIR166c
(16 sentences)

Stem-loop
   -------ugaa  -ug          uugcu      u      uu         a         caugu   uu     -    c    u   c 
5'            ga   ugaagcuauu     ucuggg ggaaug  gucugguuc aggucuugc     gau  gagga ugaa gguu gug a
              ||   ||||||||||     |||||| ||||||  ||||||||| |||||||||     |||  ||||| |||| |||| |||  
3'            cu   acuucgauag     agacuc ccuuac  cggaccagg ucuagggcg     uug  cucuu acuu ucaa uac u
   ccgaucuagag  caa          -----      c      uu         c         ----u   uu     u    -    -   g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
3: 33098767-33098938 [+]
intergenic
Database links

Mature sequence bdi-miR166c-5p

Accession MIMAT0027064
Sequence

31 - 

ggaauguugucugguucaagg

 - 51

Get sequence
Evidence experimental; Illumina [2]

Mature sequence bdi-miR166c-3p

Accession MIMAT0020688
Sequence

121 - 

ucggaccaggcuucauucccc

 - 141

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:21371551 "Implementation of a de novo genome-wide computational approach for updating Brachypodium miRNAs" Baev V, Milev I, Naydenov M, Apostolova E, Minkov G, Minkov I, Yahubyan G Genomics. 97:282-293(2011).
2
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).