Stem-loop sequence bdi-MIR169e

AccessionMI0018114 (change log)
DescriptionBrachypodium distachyon miR169e stem-loop
Gene family MIPF0000012; MIR169_1
Literature search

4 open access papers mention bdi-MIR169e
(32 sentences)

Stem-loop
   ---   ua     -u          uug    -uga          u    u       c   ucc  ccuu      u      auu 
5'    ccu  caugg  gauaaggggu   gccc    uagccaagga gacu gccugug aug   uc    gaucgc ugcaua   u
      |||  |||||  ||||||||||   ||||    |||||||||| |||| ||||||| |||   ||    |||||| ||||||    
3'    gga  guacc  cuauucuccg   uggg    aucgguuccu cuga cggacac uau   ag    cuagug acguau   c
   ucc   uc     uc          ---    uccg          -    -       -   -uu  --cu      u      aua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
3: 43441526-43441689 [+]
intergenic
Clustered miRNAs
< 10kb from bdi-MIR169e
bdi-MIR169e3: 43441526-43441689 [+]
bdi-MIR169g3: 43444486-43444666 [+]
Database links

Mature sequence bdi-miR169e-5p

Accession MIMAT0020689
Sequence

32 - 

uagccaaggaugacuugccug

 - 52

Get sequence
Evidence experimental; Illumina [2]

Mature sequence bdi-miR169e-3p

Accession MIMAT0027065
Sequence

115 - 

ggcagucuccuuggcuagc

 - 133

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:21371551 "Implementation of a de novo genome-wide computational approach for updating Brachypodium miRNAs" Baev V, Milev I, Naydenov M, Apostolova E, Minkov G, Minkov I, Yahubyan G Genomics. 97:282-293(2011).
2
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).