Stem-loop sequence bdi-MIR159a

AccessionMI0018117 (change log)
Previous IDsbdi-MIR159
DescriptionBrachypodium distachyon miR159 stem-loop
Gene family MIPF0000010; MIR159
Stem-loop
   -------   ca  c  a   uauagaca   a  a                  uc  g         ----    c  aug  g  g    u     g u   --   cu     au    u  gg 
5'        ggg  ag ga aga        aga ga gagcucccuucgauccaa  ca gaggggaag    uggu gg   ca cu ccgg ucaug a acc  ugu  ggugc  gcag gu  u
          |||  || || |||        ||| || ||||||||||||||||||  || |||||||||    |||| ||   || || |||| ||||| | |||  |||  |||||  |||| ||  a
3'        ccc  uc cu ucu        ucu cu cucgagggaaguuagguu  gu cucccuuuc    accg cc   gu ga ggcc aguac u ugg  acg  ccacg  cguc cg  a
   ucucucu   uc  u  c   --cccccc   -  -                  -c  g         ugcg    u  -aa  a  g    c     g u   cu   -u     --    -  au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
2: 5602219-5602452 [+]
intergenic
Database links

Mature sequence bdi-miR159a-5p

Accession MIMAT0027066
Previous IDsbdi-miR159-5p
Sequence

31 - 

agcucccuucgauccaauc

 - 49

Get sequence
Evidence experimental; Illumina [2]

Mature sequence bdi-miR159a-3p

Accession MIMAT0020692
Previous IDsbdi-miR159-3p
Sequence

184 - 

cuuggauugaagggagcucu

 - 203

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:21371551 "Implementation of a de novo genome-wide computational approach for updating Brachypodium miRNAs" Baev V, Milev I, Naydenov M, Apostolova E, Minkov G, Minkov I, Yahubyan G Genomics. 97:282-293(2011).
2
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).