Stem-loop sequence bdi-MIR169a

AccessionMI0018120 (change log)
DescriptionBrachypodium distachyon miR169a stem-loop
Gene family MIPF0000037; MIR169_2
Literature search

3 open access papers mention bdi-MIR169a
(28 sentences)

Stem-loop
   ggaaggguaggauacguuuuugcuugcccgu    gcgc      u   cu    ga   u    c         ug             aacga    c 
5'                                ggcc    uaacau agg  uggg  cua ggug agccaagga  acuugccgaucga     ugca a
                                  ||||    |||||| |||  ||||  ||| |||| |||||||||  |||||||||||||     |||| a
3'                                ccgg    auugua ucc  gucc  gau cuac ucgguucuu  ugagcggcuagcu     acgu u
   -------------auguaugguggcguacgg    ----      c   cc    uc   u    a         gu             -----    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence bdi-miR169a-5p

Accession MIMAT0020695
Sequence

66 - 

cagccaaggaugacuugccga

 - 86

Get sequence
Evidence experimental; Illumina [2-3]

Mature sequence bdi-miR169a-3p

Accession MIMAT0027068
Sequence

115 - 

ggcgaguuguucuuggcuaca

 - 135

Get sequence
Evidence experimental; Illumina [2-3]

References

1
PMID:21371551 "Implementation of a de novo genome-wide computational approach for updating Brachypodium miRNAs" Baev V, Milev I, Naydenov M, Apostolova E, Minkov G, Minkov I, Yahubyan G Genomics. 97:282-293(2011).
2
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).
3
PMID:24367943 "Parallel analysis of RNA ends enhances global investigation of microRNAs and target RNAs of Brachypodium distachyon" Jeong DH, Schmidt SA, Rymarquis LA, Park S, Ganssmann M, German MA, Accerbi M, Zhai J, Fahlgren N, Fox SE, Garvin DF, Mockler TC, Carrington JC, Meyers BC, Green PJ Genome Biol. 14:R145(2013).