Stem-loop sequence bdi-MIR156d

AccessionMI0018122 (change log)
DescriptionBrachypodium distachyon miR156d stem-loop
Gene family MIPF0000008; MIR156
Literature search

5 open access papers mention bdi-MIR156d
(26 sentences)

Stem-loop
   --gccggccggcagggucaugugugcgcgc         -    -         a      ggcgg         cgg 
5'                               ggugacaga agag agugagcac cggccg     gacggcacc   c
                                 ||||||||| |||| ||||||||| ||||||     |||||||||   g
3'                               ccacugucu ucuc ucacucgug gccggc     cugccgugg   g
   acaggcacuucuccgccggaagacccguuu         g    g         c      ----g         uua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
5: 18202182-18202332 [-]
intergenic
Database links

Mature sequence bdi-miR156d-5p

Accession MIMAT0020697
Sequence

31 - 

ugacagaagagagugagcac

 - 50

Get sequence
Evidence experimental; Illumina [2]

Mature sequence bdi-miR156d-3p

Accession MIMAT0027069
Sequence

100 - 

gcucacugcucugucugucacc

 - 121

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:21371551 "Implementation of a de novo genome-wide computational approach for updating Brachypodium miRNAs" Baev V, Milev I, Naydenov M, Apostolova E, Minkov G, Minkov I, Yahubyan G Genomics. 97:282-293(2011).
2
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).