Stem-loop sequence bdi-MIR169c

AccessionMI0018126 (change log)
DescriptionBrachypodium distachyon miR169c stem-loop
Gene family MIPF0000037; MIR169_2
Literature search

3 open access papers mention bdi-MIR169c
(28 sentences)

Stem-loop
   -uu    u      a    c      -g   a  c         ug           ccugguguugggggaauug 
5'    gcca acgcua gagg agagaa  ggg ug agccaagga  acuugccggcu                   c
      |||| |||||| |||| ||||||  ||| || |||||||||  |||||||||||                   a
3'    cggu uguggu cuuc ucucuu  ucc ac ucgguuccu  uggacggccga                   g
   ucc    u      -    u      ga   -  a         gu           uugaguuccgaguuguuuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
5: 23763870-23764020 [-]
intergenic
Database links

Mature sequence bdi-miR169c-5p

Accession MIMAT0020701
Sequence

33 - 

cagccaaggaugacuugccgg

 - 53

Get sequence
Evidence experimental; Illumina [2]

Mature sequence bdi-miR169c-3p

Accession MIMAT0027073
Sequence

101 - 

ggcagguuguccuuggcuac

 - 120

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:21371551 "Implementation of a de novo genome-wide computational approach for updating Brachypodium miRNAs" Baev V, Milev I, Naydenov M, Apostolova E, Minkov G, Minkov I, Yahubyan G Genomics. 97:282-293(2011).
2
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).