Stem-loop sequence bdi-MIR395c

AccessionMI0018127 (change log)
DescriptionBrachypodium distachyon miR395c stem-loop
Gene family MIPF0000016; MIR395
Literature search

3 open access papers mention bdi-MIR395c
(32 sentences)

Stem-loop
   ----ggcggcagaccac              u         g            - a     aau 
5'                  guuugguaauacca gaguucccu caagcacuucau g ggccu   u
                    |||||||||||||| ||||||||| |||||||||||| | |||||    
3'                  cgaaccauuguggu cucaagggg guuugugaagug c ucggg   c
   gaggaaaacaacauuuu              u         -            u a     aau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
5: 25455997-25456122 [+]
intergenic
Clustered miRNAs
< 10kb from bdi-MIR395c
bdi-MIR395e5: 25455195-25455344 [+]
bdi-MIR395f5: 25455426-25455521 [+]
bdi-MIR395g5: 25455723-25455811 [+]
bdi-MIR395h5: 25455882-25455957 [+]
bdi-MIR395c5: 25455997-25456122 [+]
bdi-MIR395j5: 25456151-25456238 [+]
bdi-MIR395k5: 25456290-25456375 [+]
bdi-MIR395p5: 25456430-25456518 [+]
bdi-MIR395l5: 25456562-25456657 [+]
bdi-MIR395q5: 25456843-25456926 [+]
bdi-MIR395n5: 25457116-25457205 [+]
Database links

Mature sequence bdi-miR395c-5p

Accession MIMAT0027074
Sequence

31 - 

guucccugcaagcacuucaug

 - 51

Get sequence
Evidence experimental; Illumina [3]

Mature sequence bdi-miR395c-3p

Accession MIMAT0020702
Sequence

75 - 

ugaaguguuugggggaacuc

 - 94

Get sequence
Evidence experimental; Illumina [1,3]

References

1
2
PMID:21371551 "Implementation of a de novo genome-wide computational approach for updating Brachypodium miRNAs" Baev V, Milev I, Naydenov M, Apostolova E, Minkov G, Minkov I, Yahubyan G Genomics. 97:282-293(2011).
3
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).