![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence bdi-MIR395c |
||||||||||||||||||||||||
Accession | MI0018127 (change log) | |||||||||||||||||||||||
Description | Brachypodium distachyon miR395c stem-loop | |||||||||||||||||||||||
Gene family | MIPF0000016; MIR395 | |||||||||||||||||||||||
Literature search |
![]()
3 open access papers mention bdi-MIR395c | |||||||||||||||||||||||
Stem-loop |
----ggcggcagaccac u g - a aau 5' guuugguaauacca gaguucccu caagcacuucau g ggccu u |||||||||||||| ||||||||| |||||||||||| | ||||| 3' cgaaccauuguggu cucaagggg guuugugaagug c ucggg c gaggaaaacaacauuuu u - u a aau |
|||||||||||||||||||||||
Confidence |
Annotation confidence: not enough data
| |||||||||||||||||||||||
Genome context |
|
|||||||||||||||||||||||
Clustered miRNAs |
|
|||||||||||||||||||||||
Database links |
|
Mature sequence bdi-miR395c-5p |
|
Accession | MIMAT0027074 |
Sequence |
31 - guucccugcaagcacuucaug - 51 |
Evidence | experimental; Illumina [3] |
Mature sequence bdi-miR395c-3p |
|
Accession | MIMAT0020702 |
Sequence |
75 - ugaaguguuugggggaacuc - 94 |
Evidence | experimental; Illumina [1,3] |
References |
|
1 |
PMID:19772667
"Deep sequencing of Brachypodium small RNAs at the global genome level identifies microRNAs involved in cold stress response"
BMC Genomics. 10:449(2009).
|
2 |
PMID:21371551
"Implementation of a de novo genome-wide computational approach for updating Brachypodium miRNAs"
Genomics. 97:282-293(2011).
|
3 |
PMID:23264558
"Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon"
Mol Plant. 6:423-443(2013).
|