Stem-loop sequence bdi-MIR5167a

AccessionMI0018134 (change log)
Previous IDsbdi-MIR5167
DescriptionBrachypodium distachyon miR5167 stem-loop
Gene family MIPF0001714; MIR5167
Stem-loop
   auugacau      -          uc    c          u              a      g            -a       -a     au   g   uc              -ucc   ---g g a   -    a agcg  ag  g 
5'         gccaga ccuuuugagu  uugc gcuuuccacu ugggugucauuggu cucuag uaagguaauuca  uuggaag  uagaa  cua auu  uuauguugccuucc    aug    u c gca gaag g    gc  ug c
           |||||| ||||||||||  |||| |||||||||| |||||||||||||| |||||| ||||||||||||  |||||||  |||||  ||| |||  ||||||||||||||    |||    | | ||| |||| |    ||  ||  
3'         ugguuu ggaaaacuca  aacg ugaaagguga acccacaguaacca gagauc auuccauuaagu  gaucuuc  aucuu  gau uaa  aauauaacggaagg    ugc    a g cgu cuuc c    cg  ac a
   -----uuc      u          ua    c          u              c      a            ga       cg     cc   a   ga              uucu   auua g g   u    a ---a  ga  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
4: 42126781-42127074 [-]
intergenic
Clustered miRNAs
< 10kb from bdi-MIR5167a
bdi-MIR5167b4: 42129670-42129875 [-]
bdi-MIR5167a4: 42126781-42127074 [-]
Database links

Mature sequence bdi-miR5167a-5p

Accession MIMAT0020709
Previous IDsbdi-miR5167-5p
Sequence

37 - 

ccacuuugggugucauuggua

 - 57

Get sequence
Evidence experimental; Illumina [2]

Mature sequence bdi-miR5167a-3p

Accession MIMAT0027078
Previous IDsbdi-miR5167-3p
Sequence

244 - 

ccaaugacacccauaguggaa

 - 264

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:21371551 "Implementation of a de novo genome-wide computational approach for updating Brachypodium miRNAs" Baev V, Milev I, Naydenov M, Apostolova E, Minkov G, Minkov I, Yahubyan G Genomics. 97:282-293(2011).
2
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).