Stem-loop sequence bdi-MIR5171a

AccessionMI0018140 (change log)
Previous IDsbdi-MIR5171
DescriptionBrachypodium distachyon miR5171 stem-loop
Gene family MIPF0000382; MIR1122
Literature search

1 open access papers mention bdi-MIR5171a
(1 sentences)

Stem-loop
   ------auucaaacauuugcc     u         cua u          c   - cg      uacauagaucuaua 
5'                      aaaau gcaugcuuc   c ucucauauua gug c  aaauuu              u
                        ||||| |||||||||   | |||||||||| ||| |  ||||||              a
3'                      uuuua uguaugaag   g aggguauaau cac g  uuuaaa              c
   gugcagucgauugcgcugcca     u         aag c          u   u aa      caaguuuauacuua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
1: 46051254-46051407 [-]
intergenic
Database links

Mature sequence bdi-miR5171a

Accession MIMAT0020715
Previous IDsbdi-miR5171
Sequence

101 - 

acuuaauaugggacggaagaa

 - 121

Get sequence
Evidence not experimental

References

1
PMID:21371551 "Implementation of a de novo genome-wide computational approach for updating Brachypodium miRNAs" Baev V, Milev I, Naydenov M, Apostolova E, Minkov G, Minkov I, Yahubyan G Genomics. 97:282-293(2011).