Stem-loop sequence bdi-MIR5172

AccessionMI0018141 (change log)
DescriptionBrachypodium distachyon miR5172 stem-loop
Stem-loop
   ccucuugacac        cc  a                                      aaggaucaggcaaagaagaacccuugaauucaauccuaccaaggagcuaguauacgucuuauugcagugcuugcaacgccaagcuuuugauccaucggaauuuuuccccuuaggugcagcgaggggaauuau 
5'            uauguacu  aa uucuuuuugccgaggagcuaguagaucgggaugaaguc                                                                                                                                    g
              ||||||||  || ||||||||||||||||||||||||||||||||||||||                                                                                                                                     
3'            auacauga  uu aagaaagacggcuccucgaucaucuaguccuacuucag                                                                                                                                    a
   -uuacauucuc        ac  a                                      cuccuccgacugcgccuguaacuagaguuguuacagccacuacuuguaugagcagggcuacugcugagccugcuucuucuaguuagcagguucgucccaugacgauuuguccguuuuggggaugaacuacuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
1: 44311568-44311956 [+]
intergenic
Database links

Mature sequence bdi-miR5172-5p

Accession MIMAT0027080
Sequence

35 - 

cgaggagcuaguagaucggga

 - 55

Get sequence
Evidence experimental; Illumina [2]

Mature sequence bdi-miR5172-3p

Accession MIMAT0020716
Sequence

339 - 

ugaucuacuagcuccucggca

 - 359

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:21371551 "Implementation of a de novo genome-wide computational approach for updating Brachypodium miRNAs" Baev V, Milev I, Naydenov M, Apostolova E, Minkov G, Minkov I, Yahubyan G Genomics. 97:282-293(2011).
2
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).