Stem-loop sequence bdi-MIR5173

AccessionMI0018142 (change log)
DescriptionBrachypodium distachyon miR5173 stem-loop
Stem-loop
   ----       c          g        u                       a      c ug c  c   ccau       -  gacuag 
5'     gagaugc uggcuguaua ggccguau cuucucguauaugcggauguacc uaugga c  a uu aag    gguucgg uc      a
       ||||||| |||||||||| |||||||| ||||||||||||||||||||||| |||||| |  | || |||    ||||||| ||       
3'     cucuaug accgauauau ccggcaua gaagagcauauaugucuacgugg auacuu g  u aa uuc    ccgagcc gg      c
   uuag       -          g        -                       c      a gu u  a   --uu       c  acuacg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
1: 22135899-22136079 [-]
intergenic
Database links

Mature sequence bdi-miR5173-5p

Accession MIMAT0020717
Sequence

31 - 

ucucguauaugcggauguacc

 - 51

Get sequence
Evidence experimental; Illumina [2]

Mature sequence bdi-miR5173-3p

Accession MIMAT0027081
Sequence

131 - 

ugcaucuguauauacgagaag

 - 151

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:21371551 "Implementation of a de novo genome-wide computational approach for updating Brachypodium miRNAs" Baev V, Milev I, Naydenov M, Apostolova E, Minkov G, Minkov I, Yahubyan G Genomics. 97:282-293(2011).
2
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).