Stem-loop sequence bdi-MIR5174a

AccessionMI0018143 (change log)
Previous IDsbdi-MIR5174
DescriptionBrachypodium distachyon miR5174 stem-loop
Gene family MIPF0001200; MIR5067
Literature search

1 open access papers mention bdi-MIR5174a
(3 sentences)

Stem-loop
   ------------------------------caaguuuauuaaaauucauagaucu    ua       c                a          g 
5'                                                        uacu  cuccguu cauaaagauuggcgug auuugaacua a
                                                          ||||  ||||||| |||||||||||||||| ||||||||||  
3'                                                        auga  gaggcaa guauuucuaaccgugc uaaauuugau g
   ucgagaugcagcugagcuagaacguuuuagacgguucaguacugacugagacaac    gg       a                c          c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
1: 45787966-45788131 [-]
intergenic
Database links

Mature sequence bdi-miR5174a

Accession MIMAT0020718
Previous IDsbdi-miR5174
Sequence

32 - 

cuccguuccauaaagauuggc

 - 52

Get sequence
Evidence not experimental

References

1
PMID:21371551 "Implementation of a de novo genome-wide computational approach for updating Brachypodium miRNAs" Baev V, Milev I, Naydenov M, Apostolova E, Minkov G, Minkov I, Yahubyan G Genomics. 97:282-293(2011).