Stem-loop sequence bdi-MIR5175a

AccessionMI0018144 (change log)
DescriptionBrachypodium distachyon miR5175a stem-loop
Gene family MIPF0001200; MIR5067
Literature search

2 open access papers mention bdi-MIR5175a
(2 sentences)

Stem-loop
   ---  cu ug ccaccc    ccau     c                      c  c         u  a 
5'    ga  g  g      auua    aagua uucuucuguuccuaaauucuua cg uguuuuagu ca a
      ||  |  |      ||||    ||||| |||||||||||||||||||||| || ||||||||| ||  
3'    cu  c  u      uaau    uucau agggaggcaaggauuuaagaau gc acaaaauca gu u
   uac  cu gu -cuauu    -acu     a                      a  a         u  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
1: 15325058-15325194 [+]
intergenic
Database links

Mature sequence bdi-miR5175a

Accession MIMAT0020719
Sequence

88 - 

aagaauuuaggaacggaggga

 - 108

Get sequence
Evidence not experimental

References

1
PMID:21371551 "Implementation of a de novo genome-wide computational approach for updating Brachypodium miRNAs" Baev V, Milev I, Naydenov M, Apostolova E, Minkov G, Minkov I, Yahubyan G Genomics. 97:282-293(2011).