Stem-loop sequence bdi-MIR5175b

AccessionMI0018146 (change log)
DescriptionBrachypodium distachyon miR5175b stem-loop
Gene family MIPF0001200; MIR5067
Literature search

2 open access papers mention bdi-MIR5175b
(2 sentences)

Stem-loop
   ucc     ---  u  uu     a    gaac                           auu        u  a 
5'    aaguu   gg gu  gcgug uuca    uacuuccucuguuccuaaauucuuguc   guuuuagu ca a
      |||||   || ||  ||||| ||||    |||||||||||||||||||||||||||   |||||||| ||  
3'    uucga   cc ca  cguau gagu    augagggagguaaggauuuaagaacag   cgaaauua gu u
   -uu     uuc  u  -u     a    ----                           cac        u  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
3: 19465406-19465546 [+]
intergenic
Database links

Mature sequence bdi-miR5175b

Accession MIMAT0020722
Sequence

35 - 

ccucuguuccuaaauucuugu

 - 55

Get sequence
Evidence not experimental

References

1
PMID:21371551 "Implementation of a de novo genome-wide computational approach for updating Brachypodium miRNAs" Baev V, Milev I, Naydenov M, Apostolova E, Minkov G, Minkov I, Yahubyan G Genomics. 97:282-293(2011).