Stem-loop sequence bdi-MIR395d

AccessionMI0018147 (change log)
DescriptionBrachypodium distachyon miR395d stem-loop
Gene family MIPF0000016; MIR395
Literature search

3 open access papers mention bdi-MIR395d
(33 sentences)

Stem-loop
   -   ------u   g  cg  -c   u       u            uc           g agg       uccuaua 
5'  agc       ccu ga  aa  ggu gguuguu ccugggguuccc  caaacacuuca c   ucggcuu       c
    |||       ||| ||  ||  ||| ||||||| ||||||||||||  ||||||||||| |   |||||||        
3'  ucg       gga cu  uu  ccg ccaacag ggaucucaaggg  guuugugaagu g   agucgga       u
   g   ucaaacu   a  au  ua   -       u            --           g -ga       cacucga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
3: 14764296-14764443 [-]
intergenic
Database links

Mature sequence bdi-miR395d-5p

Accession MIMAT0027082
Sequence

30 - 

ugggguucccuccaaacacuuca

 - 52

Get sequence
Evidence experimental; Illumina [2]

Mature sequence bdi-miR395d-3p

Accession MIMAT0020723
Sequence

94 - 

aaguguuuggggaacucuagg

 - 114

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:21371551 "Implementation of a de novo genome-wide computational approach for updating Brachypodium miRNAs" Baev V, Milev I, Naydenov M, Apostolova E, Minkov G, Minkov I, Yahubyan G Genomics. 97:282-293(2011).
2
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).