Stem-loop sequence bdi-MIR5178

AccessionMI0018149 (change log)
DescriptionBrachypodium distachyon miR5178 stem-loop
Stem-loop
   ---       gc          a       c    ug  a                         c    ugugacuaugauccaacucugacccauagcacaauaua 
5'    auuaggg  auuugauagg aauuuaa ugcu  gg ccgccggucagagccauguggcaga aaaa                                      u
      |||||||  |||||||||| ||||||| ||||  || ||||||||||||||||||||||||| ||||                                       
3'    uaauccu  uaaacugucc uuagauu gcga  cc gguggccagucucgguauaccguuu uuuu                                      c
   cuc       -a          g       a    gu  g                         u    uggcacuagcuacccgggcucaccguuccugauucaag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
3: 8463664-8463877 [-]
intergenic
Database links

Mature sequence bdi-miR5178-5p

Accession MIMAT0027083
Sequence

31 - 

cuugggaccgccggucagagc

 - 51

Get sequence
Evidence experimental; Illumina [2]

Mature sequence bdi-miR5178-3p

Accession MIMAT0020725
Sequence

164 - 

ucugaccggugggccugagcg

 - 184

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:21371551 "Implementation of a de novo genome-wide computational approach for updating Brachypodium miRNAs" Baev V, Milev I, Naydenov M, Apostolova E, Minkov G, Minkov I, Yahubyan G Genomics. 97:282-293(2011).
2
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).