Stem-loop sequence bdi-MIR5183

AccessionMI0018156 (change log)
DescriptionBrachypodium distachyon miR5183 stem-loop
Gene family MIPF0000382; MIR1122
Literature search

1 open access papers mention bdi-MIR5183
(1 sentences)

Stem-loop
   ccugccag      g    auaaa   -   c  c           g   --     auauuuuauguaucuauacguuuuuu 
5'         gauaug uuug     ugc auc uc gauucuaaauu uug  ucgaa                          a
           |||||| ||||     ||| ||| || ||||||||||| |||  |||||                          a
3'         cuauau aaac     aug uag ag cuaagauuuga aac  aguuu                          g
   --------      -    ----g   a   -  a           g   ug     aaacagguuuauaccugcaucgauaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
2: 46665653-46665804 [-]
intergenic
Database links

Mature sequence bdi-miR5183

Accession MIMAT0020732
Sequence

98 - 

uauuuggacaaauuugaguca

 - 118

Get sequence
Evidence not experimental

References

1
PMID:21371551 "Implementation of a de novo genome-wide computational approach for updating Brachypodium miRNAs" Baev V, Milev I, Naydenov M, Apostolova E, Minkov G, Minkov I, Yahubyan G Genomics. 97:282-293(2011).