Stem-loop sequence bdi-MIR5185b

AccessionMI0018159 (change log)
DescriptionBrachypodium distachyon miR5185b stem-loop
Gene family MIPF0001246; MIR5185
Literature search

1 open access papers mention bdi-MIR5185b
(1 sentences)

Stem-loop
   --------------uuaggguuguguac  a                        u           uc        auuuu 
5'                             uc cgcgaaagucccgcuucuaguuca uuuucaaaucu  uauucaaa     g
                               || |||||||||||||||||||||||| |||||||||||  ||||||||     c
3'                             ag gcguuuucagggcgaagaucaagu aagaguuugga  auaaguuu     u
   cccgaccacucauucccacguuugcccu  g                        u           ga        aauac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
5: 6094953-6095105 [+]
intergenic
Database links

Mature sequence bdi-miR5185b-5p

Accession MIMAT0020735
Sequence

32 - 

uucuaguucauuuuucaaauc

 - 52

Get sequence
Evidence experimental; Illumina [2]

Mature sequence bdi-miR5185b-3p

Accession MIMAT0027087
Sequence

90 - 

uuugagaauugaacuagaagc

 - 110

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:21371551 "Implementation of a de novo genome-wide computational approach for updating Brachypodium miRNAs" Baev V, Milev I, Naydenov M, Apostolova E, Minkov G, Minkov I, Yahubyan G Genomics. 97:282-293(2011).
2
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).