Stem-loop sequence xtr-mir-449b

AccessionMI0018161
DescriptionXenopus tropicalis miR-449b stem-loop
Gene family MIPF0000133; mir-449
Stem-loop
   a      u g   a     u   guu     u       ugcua 
5'  ccugcu u ggu ggcag gua   uuagc ggcugcu     u
    |||||| | ||| ||||| |||   ||||| |||||||     u
3'  ggacga g cca ccguc cau   aaucg cugacga     a
   g      c g   -     u   ---     -       ccuca 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Comments

Expression of the miR-449 family sequences is validated in X. laevis by SOLID sequencing [1].

Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL173351.1: 165047-165132 [-]
sense
ENSXETT00000059419 ; xtr-mir-449b-201; exon 1
ENSXETT00000060492 ; CDC20B-201; intron 2
Clustered miRNAs
< 10kb from xtr-mir-449b
xtr-mir-449cGL173351.1: 165282-165374 [-]
xtr-mir-449bGL173351.1: 165047-165132 [-]
xtr-mir-449aGL173351.1: 164904-164990 [-]

Mature sequence xtr-miR-449b-5p

Accession MIMAT0022745
Sequence

14 - 

aggcaguguaguuuuagcugg

 - 34

Get sequence
Evidence not experimental

Mature sequence xtr-miR-449b-3p

Accession MIMAT0022746
Sequence

55 - 

cagucgcuaauacucugccacc

 - 76

Get sequence
Evidence not experimental

References

1
PMID:21602795 "Control of vertebrate multiciliogenesis by miR-449 through direct repression of the Delta/Notch pathway" Marcet B, Chevalier B, Luxardi G, Coraux C, Zaragosi LE, Cibois M, Robbe-Sermesant K, Jolly T, Cardinaud B, Moreilhon C, Giovannini-Chami L, Nawrocki-Raby B, Birembaut P, Waldmann R, Kodjabachian L, Barbry P Nat Cell Biol. 13:693-699(2011).