Stem-loop sequence xtr-mir-449c

AccessionMI0018162
DescriptionXenopus tropicalis miR-449c stem-loop
Gene family MIPF0000133; mir-449
Stem-loop
   a  uu    c     a  c      cuu      u      ugu   c 
5'  ag  ugga caaug gg agugca   gcuagc ggcugu   guu u
    ||  |||| ||||| || ||||||   |||||| ||||||   ||| g
3'  uc  acuu guuac cc ucacgu   cgaucg ucgaca   cga g
   g  uu    u     a  -      ---      -      -uu   a 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Comments

Expression of the miR-449 family sequences is validated in X. laevis by SOLID sequencing [1].

Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL173351.1: 165282-165374 [-]
sense
ENSXETT00000060492 ; CDC20B-201; intron 2
Clustered miRNAs
< 10kb from xtr-mir-449c
xtr-mir-449cGL173351.1: 165282-165374 [-]
xtr-mir-449bGL173351.1: 165047-165132 [-]
xtr-mir-449aGL173351.1: 164904-164990 [-]

Mature sequence xtr-miR-449c-5p

Accession MIMAT0022747
Sequence

16 - 

aggcagugcacuugcuagcuggcugu

 - 41

Get sequence
Evidence not experimental

Mature sequence xtr-miR-449c-3p

Accession MIMAT0022748
Sequence

60 - 

agcugcuagcugcacuccaca

 - 80

Get sequence
Evidence not experimental

References

1
PMID:21602795 "Control of vertebrate multiciliogenesis by miR-449 through direct repression of the Delta/Notch pathway" Marcet B, Chevalier B, Luxardi G, Coraux C, Zaragosi LE, Cibois M, Robbe-Sermesant K, Jolly T, Cardinaud B, Moreilhon C, Giovannini-Chami L, Nawrocki-Raby B, Birembaut P, Waldmann R, Kodjabachian L, Barbry P Nat Cell Biol. 13:693-699(2011).