Stem-loop sequence hvu-MIR166c

AccessionMI0018212 (change log)
DescriptionHordeum vulgare miR166c stem-loop
Gene family MIPF0000004; MIR166
Literature search

8 open access papers mention hvu-MIR166c
(32 sentences)

Stem-loop
            cn  g     naaaga     ncuc    g   u 
5' ggggaauga  cc ggucc      gagac    gcau gcg g
   |||||||||  || |||||      |||||    |||| |||  
3' ccccuuacu  gg ccagg      cuuug    cgug ugc c
            uc  a     ------     ----    g   g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hvu-miR166c

Accession MIMAT0020737
Sequence

58 - 

ucggaccaggcuucauucccc

 - 78

Get sequence
Evidence not experimental

References

1
PMID:20676715 "Regulation of barley miRNAs upon dehydration stress correlated with target gene expression" Kantar M, Unver T, Budak H Funct Integr Genomics. 10:493-507(2010).