Stem-loop sequence bdi-MIR395e

AccessionMI0018220 (change log)
DescriptionBrachypodium distachyon miR395e stem-loop
Gene family MIPF0000016; MIR395
Literature search

3 open access papers mention bdi-MIR395e
(33 sentences)

Stem-loop
                ug         u    u       g -a  -     ag  u u   u  uuguu   uugc    guu 
5' guugguugucacc  gaguucucc caaa cacuuca u  gc uagcu  cu g gcc cc     gca    cacu   u
   |||||||||||||  ||||||||| |||| ||||||| |  || |||||  || | ||| ||     |||    ||||    
3' cgaccaacggugg  cucaagggg guuu gugaagu a  cg gucga  ga c cgg gg     cgu    guga   u
                gu         -    -       g ca  u     ga  - -   -  ---uu   ----    aua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
5: 25455195-25455344 [+]
intergenic
Clustered miRNAs
< 10kb from bdi-MIR395e
bdi-MIR395e5: 25455195-25455344 [+]
bdi-MIR395f5: 25455426-25455521 [+]
bdi-MIR395g5: 25455723-25455811 [+]
bdi-MIR395h5: 25455882-25455957 [+]
bdi-MIR395c5: 25455997-25456122 [+]
bdi-MIR395j5: 25456151-25456238 [+]
bdi-MIR395k5: 25456290-25456375 [+]
bdi-MIR395p5: 25456430-25456518 [+]
bdi-MIR395l5: 25456562-25456657 [+]
bdi-MIR395q5: 25456843-25456926 [+]
bdi-MIR395n5: 25457116-25457205 [+]
Database links

Mature sequence bdi-miR395e-5p

Accession MIMAT0027089
Sequence

18 - 

guucuccucaaaucacuucagu

 - 39

Get sequence
Evidence experimental; Illumina [2]

Mature sequence bdi-miR395e-3p

Accession MIMAT0020745
Sequence

116 - 

ugaaguguuugggggaacuc

 - 135

Get sequence
Evidence experimental; Illumina [1-2]

References

1
2
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).